floT [2017-12-02 18:33:39]

membrane-associated scaffold protein, orchestration of physiological processes in lipid microdomains, involved in the control of membrane fluidity, confers (together with YuaF) resistance to cefuroxime

Locus: BSU31010

Isoelectric point: 5.14

Molecular weight: 55.82 kDa

Protein length: 509 aa

Gene length: 1527 bp

Function: involved in the control of membrane fluidity

Product: membrane-associated scaffold protein

Essential: no

Synonyms: yuaG, yuaH

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Membrane dynamics
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for biofilm formation
• Lifestyles → Sporulation → Sporulation/ other
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,180,465 → 3,181,994

Phenotypes of a mutant

• delayed onset of sporulation, reduced sporulation frequency
• defect in motility PubMed
• reduced protein secretion PubMed
• a floT floA double mutant does not induce KinC-dependent biofilm formation upon addition of surfactin PubMed
• a floT floA double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency PubMed
• a floT floA double mutant has a sporulation defect, due to the lack of FtsH PubMed
• a floT mutant displays a defective growth under oxygen-limiting conditions PubMed

The protein

Catalyzed reaction/ biological activity

• SigW-dependent expression of fabF and the yuaF-floT-yuaI operon result in reduced membrane fluidity PubMed
• recruits YuaF to focal assemblies PubMed
• controls protease activity of FtsH PubMed

Localization

• membrane associated PubMed
• co-localizes with FloA and KinC in discrete foci membrane PubMed
• forms discrete focal structures in the cytoplasma membrane PubMed
• 6 foci FloT of are detected in strain 3610 PubMed

Expression and Regulation

Operons

• Genes: yuaF-floT-yuaI
  Description: PubMed

  Sigma factors

  • SigW: sigma factor, PubMed, in SigW regulon

  Regulation

  • expressed upon cell wall stress (SigW) PubMed

Biological materials

Mutant

• MGNA-A213 (yuaG::erm), available at the NBRP B. subtilis, Japan
• JS152 (markerless), available in Daniel Lopez's lab
• BKE31010 (ΔfloT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC
• BKK31010 (ΔfloT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC

GFP fusion

• GK38 (168 amyE::PfloT-yfp (spc)), available in Daniel Lopez's lab
• JS280 (3610 amyE::floT-gfp(spc)), available in Daniel Lopez's lab
• JS153 (3610 lacA::floT-mEos2 (mls)), available in Daniel Lopez's lab
• JS166 (3610 lacA::floT-PAmCherry (mls)), available in Daniel Lopez's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) for FloT PubMed, available in Daniel Lopez's lab

References

Reviews

Loading

Original publications

Loading